ID: 1049265179

View in Genome Browser
Species Human (GRCh38)
Location 8:141664087-141664109
Sequence AAGTGGGTATAGACTGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049265179_1049265188 6 Left 1049265179 8:141664087-141664109 CCAGCCTCAGTCTATACCCACTT No data
Right 1049265188 8:141664116-141664138 ATCCATCTCAGCAGGACAGCGGG No data
1049265179_1049265183 -2 Left 1049265179 8:141664087-141664109 CCAGCCTCAGTCTATACCCACTT No data
Right 1049265183 8:141664108-141664130 TTCCTCCCATCCATCTCAGCAGG No data
1049265179_1049265191 24 Left 1049265179 8:141664087-141664109 CCAGCCTCAGTCTATACCCACTT No data
Right 1049265191 8:141664134-141664156 GCGGGGCCCAAGCTACTGCTTGG No data
1049265179_1049265192 25 Left 1049265179 8:141664087-141664109 CCAGCCTCAGTCTATACCCACTT No data
Right 1049265192 8:141664135-141664157 CGGGGCCCAAGCTACTGCTTGGG No data
1049265179_1049265187 5 Left 1049265179 8:141664087-141664109 CCAGCCTCAGTCTATACCCACTT No data
Right 1049265187 8:141664115-141664137 CATCCATCTCAGCAGGACAGCGG No data
1049265179_1049265189 7 Left 1049265179 8:141664087-141664109 CCAGCCTCAGTCTATACCCACTT No data
Right 1049265189 8:141664117-141664139 TCCATCTCAGCAGGACAGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049265179 Original CRISPR AAGTGGGTATAGACTGAGGC TGG (reversed) Intergenic
No off target data available for this crispr