ID: 1049267235

View in Genome Browser
Species Human (GRCh38)
Location 8:141674769-141674791
Sequence GCCCCACACCATGAGTGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049267235_1049267242 20 Left 1049267235 8:141674769-141674791 CCTGAACACTCATGGTGTGGGGC No data
Right 1049267242 8:141674812-141674834 GTCTGGTATCTGCATGCAGCTGG No data
1049267235_1049267237 -8 Left 1049267235 8:141674769-141674791 CCTGAACACTCATGGTGTGGGGC No data
Right 1049267237 8:141674784-141674806 TGTGGGGCCAGGCCTGATTCAGG No data
1049267235_1049267239 3 Left 1049267235 8:141674769-141674791 CCTGAACACTCATGGTGTGGGGC No data
Right 1049267239 8:141674795-141674817 GCCTGATTCAGGTCCTCGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049267235 Original CRISPR GCCCCACACCATGAGTGTTC AGG (reversed) Intergenic
No off target data available for this crispr