ID: 1049269057

View in Genome Browser
Species Human (GRCh38)
Location 8:141684496-141684518
Sequence GCTGAATCCCTGTCCGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049269051_1049269057 12 Left 1049269051 8:141684461-141684483 CCCAAAGATATCCTGGAAGGGGG No data
Right 1049269057 8:141684496-141684518 GCTGAATCCCTGTCCGAAGCAGG No data
1049269045_1049269057 25 Left 1049269045 8:141684448-141684470 CCATTCCTATTTGCCCAAAGATA No data
Right 1049269057 8:141684496-141684518 GCTGAATCCCTGTCCGAAGCAGG No data
1049269053_1049269057 11 Left 1049269053 8:141684462-141684484 CCAAAGATATCCTGGAAGGGGGT No data
Right 1049269057 8:141684496-141684518 GCTGAATCCCTGTCCGAAGCAGG No data
1049269046_1049269057 20 Left 1049269046 8:141684453-141684475 CCTATTTGCCCAAAGATATCCTG No data
Right 1049269057 8:141684496-141684518 GCTGAATCCCTGTCCGAAGCAGG No data
1049269055_1049269057 1 Left 1049269055 8:141684472-141684494 CCTGGAAGGGGGTCTTAGAGGCC No data
Right 1049269057 8:141684496-141684518 GCTGAATCCCTGTCCGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049269057 Original CRISPR GCTGAATCCCTGTCCGAAGC AGG Intergenic
No off target data available for this crispr