ID: 1049279611

View in Genome Browser
Species Human (GRCh38)
Location 8:141737588-141737610
Sequence CTGAACTCCGTGGGACCAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049279611_1049279621 20 Left 1049279611 8:141737588-141737610 CCTGTTGGTCCCACGGAGTTCAG No data
Right 1049279621 8:141737631-141737653 CAGACAATTTTCCCCTGGAGTGG No data
1049279611_1049279618 15 Left 1049279611 8:141737588-141737610 CCTGTTGGTCCCACGGAGTTCAG No data
Right 1049279618 8:141737626-141737648 CAGCCCAGACAATTTTCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049279611 Original CRISPR CTGAACTCCGTGGGACCAAC AGG (reversed) Intergenic
No off target data available for this crispr