ID: 1049281977

View in Genome Browser
Species Human (GRCh38)
Location 8:141754114-141754136
Sequence CTGTGGGTGAGGCGGGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049281977_1049281993 29 Left 1049281977 8:141754114-141754136 CCATTCTCCCGCCTCACCCACAG No data
Right 1049281993 8:141754166-141754188 TTGTATTTTTAGTAGAGATGGGG 0: 82079
1: 170980
2: 171502
3: 107694
4: 70628
1049281977_1049281991 27 Left 1049281977 8:141754114-141754136 CCATTCTCCCGCCTCACCCACAG No data
Right 1049281991 8:141754164-141754186 TTTTGTATTTTTAGTAGAGATGG 0: 194929
1: 143151
2: 66814
3: 37831
4: 46551
1049281977_1049281992 28 Left 1049281977 8:141754114-141754136 CCATTCTCCCGCCTCACCCACAG No data
Right 1049281992 8:141754165-141754187 TTTGTATTTTTAGTAGAGATGGG 0: 86734
1: 238723
2: 156972
3: 78020
4: 57628
1049281977_1049281984 -3 Left 1049281977 8:141754114-141754136 CCATTCTCCCGCCTCACCCACAG No data
Right 1049281984 8:141754134-141754156 CAGGCGCCCACCACCACACCCGG 0: 1653
1: 12179
2: 38867
3: 74712
4: 98800

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049281977 Original CRISPR CTGTGGGTGAGGCGGGAGAA TGG (reversed) Intergenic
No off target data available for this crispr