ID: 1049282099

View in Genome Browser
Species Human (GRCh38)
Location 8:141754798-141754820
Sequence GACCAACTTGTTTTTCAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049282097_1049282099 6 Left 1049282097 8:141754769-141754791 CCTGCATGGGTTTAACTGAACTT No data
Right 1049282099 8:141754798-141754820 GACCAACTTGTTTTTCAGAATGG No data
1049282096_1049282099 11 Left 1049282096 8:141754764-141754786 CCTAGCCTGCATGGGTTTAACTG No data
Right 1049282099 8:141754798-141754820 GACCAACTTGTTTTTCAGAATGG No data
1049282093_1049282099 25 Left 1049282093 8:141754750-141754772 CCAGGGTGCTGAGTCCTAGCCTG No data
Right 1049282099 8:141754798-141754820 GACCAACTTGTTTTTCAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049282099 Original CRISPR GACCAACTTGTTTTTCAGAA TGG Intergenic
No off target data available for this crispr