ID: 1049282185

View in Genome Browser
Species Human (GRCh38)
Location 8:141755318-141755340
Sequence CCTACTGTGAATGCCTGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049282183_1049282185 -10 Left 1049282183 8:141755305-141755327 CCATTCGGGGAATCCTACTGTGA No data
Right 1049282185 8:141755318-141755340 CCTACTGTGAATGCCTGCTTTGG No data
1049282181_1049282185 -4 Left 1049282181 8:141755299-141755321 CCCTAGCCATTCGGGGAATCCTA No data
Right 1049282185 8:141755318-141755340 CCTACTGTGAATGCCTGCTTTGG No data
1049282182_1049282185 -5 Left 1049282182 8:141755300-141755322 CCTAGCCATTCGGGGAATCCTAC No data
Right 1049282185 8:141755318-141755340 CCTACTGTGAATGCCTGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049282185 Original CRISPR CCTACTGTGAATGCCTGCTT TGG Intergenic
No off target data available for this crispr