ID: 1049286267

View in Genome Browser
Species Human (GRCh38)
Location 8:141776958-141776980
Sequence GACAGAGCCCCCACTGCGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049286262_1049286267 21 Left 1049286262 8:141776914-141776936 CCCTGGGCTGAAATTTTACATCT No data
Right 1049286267 8:141776958-141776980 GACAGAGCCCCCACTGCGAGTGG No data
1049286259_1049286267 26 Left 1049286259 8:141776909-141776931 CCCCTCCCTGGGCTGAAATTTTA No data
Right 1049286267 8:141776958-141776980 GACAGAGCCCCCACTGCGAGTGG No data
1049286264_1049286267 -5 Left 1049286264 8:141776940-141776962 CCCTCTACCGAGTGAGTTGACAG No data
Right 1049286267 8:141776958-141776980 GACAGAGCCCCCACTGCGAGTGG No data
1049286263_1049286267 20 Left 1049286263 8:141776915-141776937 CCTGGGCTGAAATTTTACATCTA No data
Right 1049286267 8:141776958-141776980 GACAGAGCCCCCACTGCGAGTGG No data
1049286258_1049286267 27 Left 1049286258 8:141776908-141776930 CCCCCTCCCTGGGCTGAAATTTT No data
Right 1049286267 8:141776958-141776980 GACAGAGCCCCCACTGCGAGTGG No data
1049286265_1049286267 -6 Left 1049286265 8:141776941-141776963 CCTCTACCGAGTGAGTTGACAGA No data
Right 1049286267 8:141776958-141776980 GACAGAGCCCCCACTGCGAGTGG No data
1049286260_1049286267 25 Left 1049286260 8:141776910-141776932 CCCTCCCTGGGCTGAAATTTTAC No data
Right 1049286267 8:141776958-141776980 GACAGAGCCCCCACTGCGAGTGG No data
1049286261_1049286267 24 Left 1049286261 8:141776911-141776933 CCTCCCTGGGCTGAAATTTTACA No data
Right 1049286267 8:141776958-141776980 GACAGAGCCCCCACTGCGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049286267 Original CRISPR GACAGAGCCCCCACTGCGAG TGG Intergenic
No off target data available for this crispr