ID: 1049290424

View in Genome Browser
Species Human (GRCh38)
Location 8:141798683-141798705
Sequence GCTGACGTGTGACAGTGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049290424_1049290434 19 Left 1049290424 8:141798683-141798705 CCCAGCCACTGTCACACGTCAGC No data
Right 1049290434 8:141798725-141798747 TCCAGAGCTAAGAGGGCGCACGG No data
1049290424_1049290436 28 Left 1049290424 8:141798683-141798705 CCCAGCCACTGTCACACGTCAGC No data
Right 1049290436 8:141798734-141798756 AAGAGGGCGCACGGCACACACGG No data
1049290424_1049290433 12 Left 1049290424 8:141798683-141798705 CCCAGCCACTGTCACACGTCAGC No data
Right 1049290433 8:141798718-141798740 CACTGTGTCCAGAGCTAAGAGGG No data
1049290424_1049290432 11 Left 1049290424 8:141798683-141798705 CCCAGCCACTGTCACACGTCAGC No data
Right 1049290432 8:141798717-141798739 CCACTGTGTCCAGAGCTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049290424 Original CRISPR GCTGACGTGTGACAGTGGCT GGG (reversed) Intergenic
No off target data available for this crispr