ID: 1049290425

View in Genome Browser
Species Human (GRCh38)
Location 8:141798684-141798706
Sequence GGCTGACGTGTGACAGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049290425_1049290434 18 Left 1049290425 8:141798684-141798706 CCAGCCACTGTCACACGTCAGCC No data
Right 1049290434 8:141798725-141798747 TCCAGAGCTAAGAGGGCGCACGG No data
1049290425_1049290433 11 Left 1049290425 8:141798684-141798706 CCAGCCACTGTCACACGTCAGCC No data
Right 1049290433 8:141798718-141798740 CACTGTGTCCAGAGCTAAGAGGG No data
1049290425_1049290432 10 Left 1049290425 8:141798684-141798706 CCAGCCACTGTCACACGTCAGCC No data
Right 1049290432 8:141798717-141798739 CCACTGTGTCCAGAGCTAAGAGG No data
1049290425_1049290436 27 Left 1049290425 8:141798684-141798706 CCAGCCACTGTCACACGTCAGCC No data
Right 1049290436 8:141798734-141798756 AAGAGGGCGCACGGCACACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049290425 Original CRISPR GGCTGACGTGTGACAGTGGC TGG (reversed) Intergenic
No off target data available for this crispr