ID: 1049290427

View in Genome Browser
Species Human (GRCh38)
Location 8:141798705-141798727
Sequence GGACACAGTGGACTCTGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049290427_1049290436 6 Left 1049290427 8:141798705-141798727 CCCACCCAGAGTCCACTGTGTCC No data
Right 1049290436 8:141798734-141798756 AAGAGGGCGCACGGCACACACGG No data
1049290427_1049290438 25 Left 1049290427 8:141798705-141798727 CCCACCCAGAGTCCACTGTGTCC No data
Right 1049290438 8:141798753-141798775 ACGGATCACCGAGGCTGAGTAGG No data
1049290427_1049290437 16 Left 1049290427 8:141798705-141798727 CCCACCCAGAGTCCACTGTGTCC No data
Right 1049290437 8:141798744-141798766 ACGGCACACACGGATCACCGAGG No data
1049290427_1049290439 26 Left 1049290427 8:141798705-141798727 CCCACCCAGAGTCCACTGTGTCC No data
Right 1049290439 8:141798754-141798776 CGGATCACCGAGGCTGAGTAGGG No data
1049290427_1049290434 -3 Left 1049290427 8:141798705-141798727 CCCACCCAGAGTCCACTGTGTCC No data
Right 1049290434 8:141798725-141798747 TCCAGAGCTAAGAGGGCGCACGG No data
1049290427_1049290433 -10 Left 1049290427 8:141798705-141798727 CCCACCCAGAGTCCACTGTGTCC No data
Right 1049290433 8:141798718-141798740 CACTGTGTCCAGAGCTAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049290427 Original CRISPR GGACACAGTGGACTCTGGGT GGG (reversed) Intergenic
No off target data available for this crispr