ID: 1049290433

View in Genome Browser
Species Human (GRCh38)
Location 8:141798718-141798740
Sequence CACTGTGTCCAGAGCTAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049290427_1049290433 -10 Left 1049290427 8:141798705-141798727 CCCACCCAGAGTCCACTGTGTCC No data
Right 1049290433 8:141798718-141798740 CACTGTGTCCAGAGCTAAGAGGG No data
1049290425_1049290433 11 Left 1049290425 8:141798684-141798706 CCAGCCACTGTCACACGTCAGCC No data
Right 1049290433 8:141798718-141798740 CACTGTGTCCAGAGCTAAGAGGG No data
1049290426_1049290433 7 Left 1049290426 8:141798688-141798710 CCACTGTCACACGTCAGCCCACC No data
Right 1049290433 8:141798718-141798740 CACTGTGTCCAGAGCTAAGAGGG No data
1049290424_1049290433 12 Left 1049290424 8:141798683-141798705 CCCAGCCACTGTCACACGTCAGC No data
Right 1049290433 8:141798718-141798740 CACTGTGTCCAGAGCTAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049290433 Original CRISPR CACTGTGTCCAGAGCTAAGA GGG Intergenic
No off target data available for this crispr