ID: 1049290567

View in Genome Browser
Species Human (GRCh38)
Location 8:141799606-141799628
Sequence GCCGCAGGTCCTCCTCTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049290567_1049290571 -6 Left 1049290567 8:141799606-141799628 CCCCACAGAGGAGGACCTGCGGC No data
Right 1049290571 8:141799623-141799645 TGCGGCCACCCCTCCTTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049290567 Original CRISPR GCCGCAGGTCCTCCTCTGTG GGG (reversed) Intergenic
No off target data available for this crispr