ID: 1049291480

View in Genome Browser
Species Human (GRCh38)
Location 8:141805261-141805283
Sequence GGGTGGACACGGGCTTGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049291480_1049291491 2 Left 1049291480 8:141805261-141805283 CCACTCCAAGCCCGTGTCCACCC No data
Right 1049291491 8:141805286-141805308 GAGAGCCTGGCAGTGCAGAAGGG No data
1049291480_1049291493 10 Left 1049291480 8:141805261-141805283 CCACTCCAAGCCCGTGTCCACCC No data
Right 1049291493 8:141805294-141805316 GGCAGTGCAGAAGGGAAGTGTGG No data
1049291480_1049291494 14 Left 1049291480 8:141805261-141805283 CCACTCCAAGCCCGTGTCCACCC No data
Right 1049291494 8:141805298-141805320 GTGCAGAAGGGAAGTGTGGTTGG No data
1049291480_1049291495 26 Left 1049291480 8:141805261-141805283 CCACTCCAAGCCCGTGTCCACCC No data
Right 1049291495 8:141805310-141805332 AGTGTGGTTGGCAGAATTTCAGG No data
1049291480_1049291490 1 Left 1049291480 8:141805261-141805283 CCACTCCAAGCCCGTGTCCACCC No data
Right 1049291490 8:141805285-141805307 GGAGAGCCTGGCAGTGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049291480 Original CRISPR GGGTGGACACGGGCTTGGAG TGG (reversed) Intergenic
No off target data available for this crispr