ID: 1049295163

View in Genome Browser
Species Human (GRCh38)
Location 8:141829207-141829229
Sequence TTTAACCTTTATGACACTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049295163_1049295170 20 Left 1049295163 8:141829207-141829229 CCTTGAGTGTCATAAAGGTTAAA No data
Right 1049295170 8:141829250-141829272 GTGAATGAGCAGGAGGAGGAGGG No data
1049295163_1049295168 16 Left 1049295163 8:141829207-141829229 CCTTGAGTGTCATAAAGGTTAAA No data
Right 1049295168 8:141829246-141829268 TAAGGTGAATGAGCAGGAGGAGG No data
1049295163_1049295165 -2 Left 1049295163 8:141829207-141829229 CCTTGAGTGTCATAAAGGTTAAA No data
Right 1049295165 8:141829228-141829250 AATGGTGCAATCATGTCTTAAGG No data
1049295163_1049295169 19 Left 1049295163 8:141829207-141829229 CCTTGAGTGTCATAAAGGTTAAA No data
Right 1049295169 8:141829249-141829271 GGTGAATGAGCAGGAGGAGGAGG No data
1049295163_1049295167 13 Left 1049295163 8:141829207-141829229 CCTTGAGTGTCATAAAGGTTAAA No data
Right 1049295167 8:141829243-141829265 TCTTAAGGTGAATGAGCAGGAGG No data
1049295163_1049295166 10 Left 1049295163 8:141829207-141829229 CCTTGAGTGTCATAAAGGTTAAA No data
Right 1049295166 8:141829240-141829262 ATGTCTTAAGGTGAATGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049295163 Original CRISPR TTTAACCTTTATGACACTCA AGG (reversed) Intergenic
No off target data available for this crispr