ID: 1049295170

View in Genome Browser
Species Human (GRCh38)
Location 8:141829250-141829272
Sequence GTGAATGAGCAGGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049295163_1049295170 20 Left 1049295163 8:141829207-141829229 CCTTGAGTGTCATAAAGGTTAAA No data
Right 1049295170 8:141829250-141829272 GTGAATGAGCAGGAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049295170 Original CRISPR GTGAATGAGCAGGAGGAGGA GGG Intergenic
No off target data available for this crispr