ID: 1049295723

View in Genome Browser
Species Human (GRCh38)
Location 8:141835441-141835463
Sequence CCTTCCAAGGTCACACCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049295723_1049295728 20 Left 1049295723 8:141835441-141835463 CCTTGAGGTGTGACCTTGGAAGG No data
Right 1049295728 8:141835484-141835506 CTCTTTGATGTAGGCGTTCAGGG No data
1049295723_1049295726 11 Left 1049295723 8:141835441-141835463 CCTTGAGGTGTGACCTTGGAAGG No data
Right 1049295726 8:141835475-141835497 TCTTTCAGTCTCTTTGATGTAGG No data
1049295723_1049295727 19 Left 1049295723 8:141835441-141835463 CCTTGAGGTGTGACCTTGGAAGG No data
Right 1049295727 8:141835483-141835505 TCTCTTTGATGTAGGCGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049295723 Original CRISPR CCTTCCAAGGTCACACCTCA AGG (reversed) Intergenic
No off target data available for this crispr