ID: 1049296547

View in Genome Browser
Species Human (GRCh38)
Location 8:141843504-141843526
Sequence CTGAATGAGCAGCAGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049296538_1049296547 24 Left 1049296538 8:141843457-141843479 CCCTCTGTAGGGGGTTGGCGTCT No data
Right 1049296547 8:141843504-141843526 CTGAATGAGCAGCAGGAGCAGGG No data
1049296537_1049296547 25 Left 1049296537 8:141843456-141843478 CCCCTCTGTAGGGGGTTGGCGTC No data
Right 1049296547 8:141843504-141843526 CTGAATGAGCAGCAGGAGCAGGG No data
1049296544_1049296547 -8 Left 1049296544 8:141843489-141843511 CCAGCTGGACTTGGGCTGAATGA No data
Right 1049296547 8:141843504-141843526 CTGAATGAGCAGCAGGAGCAGGG No data
1049296539_1049296547 23 Left 1049296539 8:141843458-141843480 CCTCTGTAGGGGGTTGGCGTCTG No data
Right 1049296547 8:141843504-141843526 CTGAATGAGCAGCAGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049296547 Original CRISPR CTGAATGAGCAGCAGGAGCA GGG Intergenic
No off target data available for this crispr