ID: 1049303417

View in Genome Browser
Species Human (GRCh38)
Location 8:141883826-141883848
Sequence CAGGATGTGATGAGCCCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049303417_1049303420 -4 Left 1049303417 8:141883826-141883848 CCCACTGGGCTCATCACATCCTG No data
Right 1049303420 8:141883845-141883867 CCTGTGTCCTGCCCCGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049303417 Original CRISPR CAGGATGTGATGAGCCCAGT GGG (reversed) Intergenic
No off target data available for this crispr