ID: 1049305234

View in Genome Browser
Species Human (GRCh38)
Location 8:141899345-141899367
Sequence CTGCTACACACTAGGTGCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049305234_1049305237 9 Left 1049305234 8:141899345-141899367 CCAATGCACCTAGTGTGTAGCAG No data
Right 1049305237 8:141899377-141899399 CTCGTTCCTCCTCTTTGATGTGG No data
1049305234_1049305238 10 Left 1049305234 8:141899345-141899367 CCAATGCACCTAGTGTGTAGCAG No data
Right 1049305238 8:141899378-141899400 TCGTTCCTCCTCTTTGATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049305234 Original CRISPR CTGCTACACACTAGGTGCAT TGG (reversed) Intergenic
No off target data available for this crispr