ID: 1049305235

View in Genome Browser
Species Human (GRCh38)
Location 8:141899353-141899375
Sequence GGCTCTCTCTGCTACACACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049305235_1049305237 1 Left 1049305235 8:141899353-141899375 CCTAGTGTGTAGCAGAGAGAGCC No data
Right 1049305237 8:141899377-141899399 CTCGTTCCTCCTCTTTGATGTGG No data
1049305235_1049305242 26 Left 1049305235 8:141899353-141899375 CCTAGTGTGTAGCAGAGAGAGCC No data
Right 1049305242 8:141899402-141899424 AAACCCGAGTGAACTCTGCCGGG No data
1049305235_1049305238 2 Left 1049305235 8:141899353-141899375 CCTAGTGTGTAGCAGAGAGAGCC No data
Right 1049305238 8:141899378-141899400 TCGTTCCTCCTCTTTGATGTGGG No data
1049305235_1049305241 25 Left 1049305235 8:141899353-141899375 CCTAGTGTGTAGCAGAGAGAGCC No data
Right 1049305241 8:141899401-141899423 CAAACCCGAGTGAACTCTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049305235 Original CRISPR GGCTCTCTCTGCTACACACT AGG (reversed) Intergenic
No off target data available for this crispr