ID: 1049305237

View in Genome Browser
Species Human (GRCh38)
Location 8:141899377-141899399
Sequence CTCGTTCCTCCTCTTTGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049305234_1049305237 9 Left 1049305234 8:141899345-141899367 CCAATGCACCTAGTGTGTAGCAG No data
Right 1049305237 8:141899377-141899399 CTCGTTCCTCCTCTTTGATGTGG No data
1049305235_1049305237 1 Left 1049305235 8:141899353-141899375 CCTAGTGTGTAGCAGAGAGAGCC No data
Right 1049305237 8:141899377-141899399 CTCGTTCCTCCTCTTTGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049305237 Original CRISPR CTCGTTCCTCCTCTTTGATG TGG Intergenic
No off target data available for this crispr