ID: 1049306502

View in Genome Browser
Species Human (GRCh38)
Location 8:141906956-141906978
Sequence CCCCACATGCAGCAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049306502_1049306508 -8 Left 1049306502 8:141906956-141906978 CCTTCCTCCTGCTGCATGTGGGG No data
Right 1049306508 8:141906971-141906993 ATGTGGGGAATGGGCACTTATGG No data
1049306502_1049306511 14 Left 1049306502 8:141906956-141906978 CCTTCCTCCTGCTGCATGTGGGG No data
Right 1049306511 8:141906993-141907015 GATTACACCTAAGGGCGCCCTGG No data
1049306502_1049306509 5 Left 1049306502 8:141906956-141906978 CCTTCCTCCTGCTGCATGTGGGG No data
Right 1049306509 8:141906984-141907006 GCACTTATGGATTACACCTAAGG No data
1049306502_1049306510 6 Left 1049306502 8:141906956-141906978 CCTTCCTCCTGCTGCATGTGGGG No data
Right 1049306510 8:141906985-141907007 CACTTATGGATTACACCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049306502 Original CRISPR CCCCACATGCAGCAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr