ID: 1049308695

View in Genome Browser
Species Human (GRCh38)
Location 8:141921733-141921755
Sequence GAATCAGCAGCATCTCTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049308695_1049308700 -2 Left 1049308695 8:141921733-141921755 CCCCTGAGAGATGCTGCTGATTC No data
Right 1049308700 8:141921754-141921776 TCAAGGGTAGCTCAGAAAACTGG No data
1049308695_1049308701 18 Left 1049308695 8:141921733-141921755 CCCCTGAGAGATGCTGCTGATTC No data
Right 1049308701 8:141921774-141921796 TGGTCATCCAGACCTGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049308695 Original CRISPR GAATCAGCAGCATCTCTCAG GGG (reversed) Intergenic
No off target data available for this crispr