ID: 1049309835

View in Genome Browser
Species Human (GRCh38)
Location 8:141927995-141928017
Sequence GGGCTGAGCTGGACTGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049309835_1049309839 -9 Left 1049309835 8:141927995-141928017 CCGTCCTCAGTCCAGCTCAGCCC No data
Right 1049309839 8:141928009-141928031 GCTCAGCCCTCGCCTCCTGGAGG No data
1049309835_1049309850 23 Left 1049309835 8:141927995-141928017 CCGTCCTCAGTCCAGCTCAGCCC No data
Right 1049309850 8:141928041-141928063 CAGCTCGTCCCACAGCCCTGGGG No data
1049309835_1049309847 21 Left 1049309835 8:141927995-141928017 CCGTCCTCAGTCCAGCTCAGCCC No data
Right 1049309847 8:141928039-141928061 CCCAGCTCGTCCCACAGCCCTGG No data
1049309835_1049309849 22 Left 1049309835 8:141927995-141928017 CCGTCCTCAGTCCAGCTCAGCCC No data
Right 1049309849 8:141928040-141928062 CCAGCTCGTCCCACAGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049309835 Original CRISPR GGGCTGAGCTGGACTGAGGA CGG (reversed) Intergenic
No off target data available for this crispr