ID: 1049309837

View in Genome Browser
Species Human (GRCh38)
Location 8:141928006-141928028
Sequence CCAGGAGGCGAGGGCTGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049309837_1049309850 12 Left 1049309837 8:141928006-141928028 CCAGCTCAGCCCTCGCCTCCTGG No data
Right 1049309850 8:141928041-141928063 CAGCTCGTCCCACAGCCCTGGGG No data
1049309837_1049309854 27 Left 1049309837 8:141928006-141928028 CCAGCTCAGCCCTCGCCTCCTGG No data
Right 1049309854 8:141928056-141928078 CCCTGGGGCCTGCATCACCCTGG No data
1049309837_1049309849 11 Left 1049309837 8:141928006-141928028 CCAGCTCAGCCCTCGCCTCCTGG No data
Right 1049309849 8:141928040-141928062 CCAGCTCGTCCCACAGCCCTGGG No data
1049309837_1049309847 10 Left 1049309837 8:141928006-141928028 CCAGCTCAGCCCTCGCCTCCTGG No data
Right 1049309847 8:141928039-141928061 CCCAGCTCGTCCCACAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049309837 Original CRISPR CCAGGAGGCGAGGGCTGAGC TGG (reversed) Intergenic
No off target data available for this crispr