ID: 1049309838

View in Genome Browser
Species Human (GRCh38)
Location 8:141928006-141928028
Sequence CCAGCTCAGCCCTCGCCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049309828_1049309838 18 Left 1049309828 8:141927965-141927987 CCCAGCTTTGTGGATCTGCCCTC No data
Right 1049309838 8:141928006-141928028 CCAGCTCAGCCCTCGCCTCCTGG No data
1049309833_1049309838 -5 Left 1049309833 8:141927988-141928010 CCCTTTGCCGTCCTCAGTCCAGC No data
Right 1049309838 8:141928006-141928028 CCAGCTCAGCCCTCGCCTCCTGG No data
1049309829_1049309838 17 Left 1049309829 8:141927966-141927988 CCAGCTTTGTGGATCTGCCCTCC No data
Right 1049309838 8:141928006-141928028 CCAGCTCAGCCCTCGCCTCCTGG No data
1049309831_1049309838 -1 Left 1049309831 8:141927984-141928006 CCTCCCCTTTGCCGTCCTCAGTC No data
Right 1049309838 8:141928006-141928028 CCAGCTCAGCCCTCGCCTCCTGG No data
1049309832_1049309838 -4 Left 1049309832 8:141927987-141928009 CCCCTTTGCCGTCCTCAGTCCAG No data
Right 1049309838 8:141928006-141928028 CCAGCTCAGCCCTCGCCTCCTGG No data
1049309834_1049309838 -6 Left 1049309834 8:141927989-141928011 CCTTTGCCGTCCTCAGTCCAGCT No data
Right 1049309838 8:141928006-141928028 CCAGCTCAGCCCTCGCCTCCTGG No data
1049309830_1049309838 0 Left 1049309830 8:141927983-141928005 CCCTCCCCTTTGCCGTCCTCAGT No data
Right 1049309838 8:141928006-141928028 CCAGCTCAGCCCTCGCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049309838 Original CRISPR CCAGCTCAGCCCTCGCCTCC TGG Intergenic
No off target data available for this crispr