ID: 1049309839

View in Genome Browser
Species Human (GRCh38)
Location 8:141928009-141928031
Sequence GCTCAGCCCTCGCCTCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049309834_1049309839 -3 Left 1049309834 8:141927989-141928011 CCTTTGCCGTCCTCAGTCCAGCT No data
Right 1049309839 8:141928009-141928031 GCTCAGCCCTCGCCTCCTGGAGG No data
1049309835_1049309839 -9 Left 1049309835 8:141927995-141928017 CCGTCCTCAGTCCAGCTCAGCCC No data
Right 1049309839 8:141928009-141928031 GCTCAGCCCTCGCCTCCTGGAGG No data
1049309832_1049309839 -1 Left 1049309832 8:141927987-141928009 CCCCTTTGCCGTCCTCAGTCCAG No data
Right 1049309839 8:141928009-141928031 GCTCAGCCCTCGCCTCCTGGAGG No data
1049309831_1049309839 2 Left 1049309831 8:141927984-141928006 CCTCCCCTTTGCCGTCCTCAGTC No data
Right 1049309839 8:141928009-141928031 GCTCAGCCCTCGCCTCCTGGAGG No data
1049309833_1049309839 -2 Left 1049309833 8:141927988-141928010 CCCTTTGCCGTCCTCAGTCCAGC No data
Right 1049309839 8:141928009-141928031 GCTCAGCCCTCGCCTCCTGGAGG No data
1049309830_1049309839 3 Left 1049309830 8:141927983-141928005 CCCTCCCCTTTGCCGTCCTCAGT No data
Right 1049309839 8:141928009-141928031 GCTCAGCCCTCGCCTCCTGGAGG No data
1049309829_1049309839 20 Left 1049309829 8:141927966-141927988 CCAGCTTTGTGGATCTGCCCTCC No data
Right 1049309839 8:141928009-141928031 GCTCAGCCCTCGCCTCCTGGAGG No data
1049309828_1049309839 21 Left 1049309828 8:141927965-141927987 CCCAGCTTTGTGGATCTGCCCTC No data
Right 1049309839 8:141928009-141928031 GCTCAGCCCTCGCCTCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049309839 Original CRISPR GCTCAGCCCTCGCCTCCTGG AGG Intergenic
No off target data available for this crispr