ID: 1049309841

View in Genome Browser
Species Human (GRCh38)
Location 8:141928016-141928038
Sequence CTGGGTTCCTCCAGGAGGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049309841_1049309850 2 Left 1049309841 8:141928016-141928038 CCTCGCCTCCTGGAGGAACCCAG No data
Right 1049309850 8:141928041-141928063 CAGCTCGTCCCACAGCCCTGGGG No data
1049309841_1049309854 17 Left 1049309841 8:141928016-141928038 CCTCGCCTCCTGGAGGAACCCAG No data
Right 1049309854 8:141928056-141928078 CCCTGGGGCCTGCATCACCCTGG No data
1049309841_1049309847 0 Left 1049309841 8:141928016-141928038 CCTCGCCTCCTGGAGGAACCCAG No data
Right 1049309847 8:141928039-141928061 CCCAGCTCGTCCCACAGCCCTGG No data
1049309841_1049309849 1 Left 1049309841 8:141928016-141928038 CCTCGCCTCCTGGAGGAACCCAG No data
Right 1049309849 8:141928040-141928062 CCAGCTCGTCCCACAGCCCTGGG No data
1049309841_1049309856 21 Left 1049309841 8:141928016-141928038 CCTCGCCTCCTGGAGGAACCCAG No data
Right 1049309856 8:141928060-141928082 GGGGCCTGCATCACCCTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049309841 Original CRISPR CTGGGTTCCTCCAGGAGGCG AGG (reversed) Intergenic
No off target data available for this crispr