ID: 1049309842

View in Genome Browser
Species Human (GRCh38)
Location 8:141928021-141928043
Sequence CTGGGCTGGGTTCCTCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049309842_1049309849 -4 Left 1049309842 8:141928021-141928043 CCTCCTGGAGGAACCCAGCCCAG No data
Right 1049309849 8:141928040-141928062 CCAGCTCGTCCCACAGCCCTGGG No data
1049309842_1049309854 12 Left 1049309842 8:141928021-141928043 CCTCCTGGAGGAACCCAGCCCAG No data
Right 1049309854 8:141928056-141928078 CCCTGGGGCCTGCATCACCCTGG No data
1049309842_1049309847 -5 Left 1049309842 8:141928021-141928043 CCTCCTGGAGGAACCCAGCCCAG No data
Right 1049309847 8:141928039-141928061 CCCAGCTCGTCCCACAGCCCTGG No data
1049309842_1049309856 16 Left 1049309842 8:141928021-141928043 CCTCCTGGAGGAACCCAGCCCAG No data
Right 1049309856 8:141928060-141928082 GGGGCCTGCATCACCCTGGATGG No data
1049309842_1049309850 -3 Left 1049309842 8:141928021-141928043 CCTCCTGGAGGAACCCAGCCCAG No data
Right 1049309850 8:141928041-141928063 CAGCTCGTCCCACAGCCCTGGGG No data
1049309842_1049309858 26 Left 1049309842 8:141928021-141928043 CCTCCTGGAGGAACCCAGCCCAG No data
Right 1049309858 8:141928070-141928092 TCACCCTGGATGGACTGAAGTGG No data
1049309842_1049309859 27 Left 1049309842 8:141928021-141928043 CCTCCTGGAGGAACCCAGCCCAG No data
Right 1049309859 8:141928071-141928093 CACCCTGGATGGACTGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049309842 Original CRISPR CTGGGCTGGGTTCCTCCAGG AGG (reversed) Intergenic
No off target data available for this crispr