ID: 1049309850

View in Genome Browser
Species Human (GRCh38)
Location 8:141928041-141928063
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049309836_1049309850 19 Left 1049309836 8:141927999-141928021 CCTCAGTCCAGCTCAGCCCTCGC No data
Right 1049309850 8:141928041-141928063 CAGCTCGTCCCACAGCCCTGGGG No data
1049309837_1049309850 12 Left 1049309837 8:141928006-141928028 CCAGCTCAGCCCTCGCCTCCTGG No data
Right 1049309850 8:141928041-141928063 CAGCTCGTCCCACAGCCCTGGGG No data
1049309834_1049309850 29 Left 1049309834 8:141927989-141928011 CCTTTGCCGTCCTCAGTCCAGCT No data
Right 1049309850 8:141928041-141928063 CAGCTCGTCCCACAGCCCTGGGG No data
1049309843_1049309850 -6 Left 1049309843 8:141928024-141928046 CCTGGAGGAACCCAGCCCAGCTC No data
Right 1049309850 8:141928041-141928063 CAGCTCGTCCCACAGCCCTGGGG No data
1049309833_1049309850 30 Left 1049309833 8:141927988-141928010 CCCTTTGCCGTCCTCAGTCCAGC No data
Right 1049309850 8:141928041-141928063 CAGCTCGTCCCACAGCCCTGGGG No data
1049309841_1049309850 2 Left 1049309841 8:141928016-141928038 CCTCGCCTCCTGGAGGAACCCAG No data
Right 1049309850 8:141928041-141928063 CAGCTCGTCCCACAGCCCTGGGG No data
1049309840_1049309850 3 Left 1049309840 8:141928015-141928037 CCCTCGCCTCCTGGAGGAACCCA No data
Right 1049309850 8:141928041-141928063 CAGCTCGTCCCACAGCCCTGGGG No data
1049309835_1049309850 23 Left 1049309835 8:141927995-141928017 CCGTCCTCAGTCCAGCTCAGCCC No data
Right 1049309850 8:141928041-141928063 CAGCTCGTCCCACAGCCCTGGGG No data
1049309842_1049309850 -3 Left 1049309842 8:141928021-141928043 CCTCCTGGAGGAACCCAGCCCAG No data
Right 1049309850 8:141928041-141928063 CAGCTCGTCCCACAGCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049309850 Original CRISPR CAGCTCGTCCCACAGCCCTG GGG Intergenic
No off target data available for this crispr