ID: 1049309856

View in Genome Browser
Species Human (GRCh38)
Location 8:141928060-141928082
Sequence GGGGCCTGCATCACCCTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049309843_1049309856 13 Left 1049309843 8:141928024-141928046 CCTGGAGGAACCCAGCCCAGCTC No data
Right 1049309856 8:141928060-141928082 GGGGCCTGCATCACCCTGGATGG No data
1049309841_1049309856 21 Left 1049309841 8:141928016-141928038 CCTCGCCTCCTGGAGGAACCCAG No data
Right 1049309856 8:141928060-141928082 GGGGCCTGCATCACCCTGGATGG No data
1049309844_1049309856 3 Left 1049309844 8:141928034-141928056 CCCAGCCCAGCTCGTCCCACAGC No data
Right 1049309856 8:141928060-141928082 GGGGCCTGCATCACCCTGGATGG No data
1049309848_1049309856 -3 Left 1049309848 8:141928040-141928062 CCAGCTCGTCCCACAGCCCTGGG No data
Right 1049309856 8:141928060-141928082 GGGGCCTGCATCACCCTGGATGG No data
1049309846_1049309856 -2 Left 1049309846 8:141928039-141928061 CCCAGCTCGTCCCACAGCCCTGG No data
Right 1049309856 8:141928060-141928082 GGGGCCTGCATCACCCTGGATGG No data
1049309845_1049309856 2 Left 1049309845 8:141928035-141928057 CCAGCCCAGCTCGTCCCACAGCC No data
Right 1049309856 8:141928060-141928082 GGGGCCTGCATCACCCTGGATGG No data
1049309840_1049309856 22 Left 1049309840 8:141928015-141928037 CCCTCGCCTCCTGGAGGAACCCA No data
Right 1049309856 8:141928060-141928082 GGGGCCTGCATCACCCTGGATGG No data
1049309842_1049309856 16 Left 1049309842 8:141928021-141928043 CCTCCTGGAGGAACCCAGCCCAG No data
Right 1049309856 8:141928060-141928082 GGGGCCTGCATCACCCTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049309856 Original CRISPR GGGGCCTGCATCACCCTGGA TGG Intergenic
No off target data available for this crispr