ID: 1049309858

View in Genome Browser
Species Human (GRCh38)
Location 8:141928070-141928092
Sequence TCACCCTGGATGGACTGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049309845_1049309858 12 Left 1049309845 8:141928035-141928057 CCAGCCCAGCTCGTCCCACAGCC No data
Right 1049309858 8:141928070-141928092 TCACCCTGGATGGACTGAAGTGG No data
1049309851_1049309858 -2 Left 1049309851 8:141928049-141928071 CCCACAGCCCTGGGGCCTGCATC No data
Right 1049309858 8:141928070-141928092 TCACCCTGGATGGACTGAAGTGG No data
1049309846_1049309858 8 Left 1049309846 8:141928039-141928061 CCCAGCTCGTCCCACAGCCCTGG No data
Right 1049309858 8:141928070-141928092 TCACCCTGGATGGACTGAAGTGG No data
1049309853_1049309858 -9 Left 1049309853 8:141928056-141928078 CCCTGGGGCCTGCATCACCCTGG No data
Right 1049309858 8:141928070-141928092 TCACCCTGGATGGACTGAAGTGG No data
1049309842_1049309858 26 Left 1049309842 8:141928021-141928043 CCTCCTGGAGGAACCCAGCCCAG No data
Right 1049309858 8:141928070-141928092 TCACCCTGGATGGACTGAAGTGG No data
1049309843_1049309858 23 Left 1049309843 8:141928024-141928046 CCTGGAGGAACCCAGCCCAGCTC No data
Right 1049309858 8:141928070-141928092 TCACCCTGGATGGACTGAAGTGG No data
1049309844_1049309858 13 Left 1049309844 8:141928034-141928056 CCCAGCCCAGCTCGTCCCACAGC No data
Right 1049309858 8:141928070-141928092 TCACCCTGGATGGACTGAAGTGG No data
1049309848_1049309858 7 Left 1049309848 8:141928040-141928062 CCAGCTCGTCCCACAGCCCTGGG No data
Right 1049309858 8:141928070-141928092 TCACCCTGGATGGACTGAAGTGG No data
1049309852_1049309858 -3 Left 1049309852 8:141928050-141928072 CCACAGCCCTGGGGCCTGCATCA No data
Right 1049309858 8:141928070-141928092 TCACCCTGGATGGACTGAAGTGG No data
1049309855_1049309858 -10 Left 1049309855 8:141928057-141928079 CCTGGGGCCTGCATCACCCTGGA No data
Right 1049309858 8:141928070-141928092 TCACCCTGGATGGACTGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049309858 Original CRISPR TCACCCTGGATGGACTGAAG TGG Intergenic
No off target data available for this crispr