ID: 1049310324

View in Genome Browser
Species Human (GRCh38)
Location 8:141930761-141930783
Sequence CCTCATCTGTAGATGCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049310324_1049310334 13 Left 1049310324 8:141930761-141930783 CCACCCTGCATCTACAGATGAGG No data
Right 1049310334 8:141930797-141930819 GAGTGGAGAAGGGACTTGCCCGG No data
1049310324_1049310331 2 Left 1049310324 8:141930761-141930783 CCACCCTGCATCTACAGATGAGG No data
Right 1049310331 8:141930786-141930808 ACCGAGGTCTGGAGTGGAGAAGG No data
1049310324_1049310330 -4 Left 1049310324 8:141930761-141930783 CCACCCTGCATCTACAGATGAGG No data
Right 1049310330 8:141930780-141930802 GAGGAAACCGAGGTCTGGAGTGG 0: 2
1: 11
2: 66
3: 408
4: 2311
1049310324_1049310329 -9 Left 1049310324 8:141930761-141930783 CCACCCTGCATCTACAGATGAGG No data
Right 1049310329 8:141930775-141930797 CAGATGAGGAAACCGAGGTCTGG No data
1049310324_1049310335 21 Left 1049310324 8:141930761-141930783 CCACCCTGCATCTACAGATGAGG No data
Right 1049310335 8:141930805-141930827 AAGGGACTTGCCCGGACCCCAGG No data
1049310324_1049310333 3 Left 1049310324 8:141930761-141930783 CCACCCTGCATCTACAGATGAGG No data
Right 1049310333 8:141930787-141930809 CCGAGGTCTGGAGTGGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049310324 Original CRISPR CCTCATCTGTAGATGCAGGG TGG (reversed) Intergenic
No off target data available for this crispr