ID: 1049310998

View in Genome Browser
Species Human (GRCh38)
Location 8:141933799-141933821
Sequence TTGCTCCTTCCCTGACACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049310998_1049311005 27 Left 1049310998 8:141933799-141933821 CCAGGGTGTCAGGGAAGGAGCAA No data
Right 1049311005 8:141933849-141933871 CCTCCTGCCTGCCGATGCACGGG No data
1049310998_1049311003 26 Left 1049310998 8:141933799-141933821 CCAGGGTGTCAGGGAAGGAGCAA No data
Right 1049311003 8:141933848-141933870 CCCTCCTGCCTGCCGATGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049310998 Original CRISPR TTGCTCCTTCCCTGACACCC TGG (reversed) Intergenic
No off target data available for this crispr