ID: 1049311140

View in Genome Browser
Species Human (GRCh38)
Location 8:141934562-141934584
Sequence TTCATTCCTCTGCAGCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049311140_1049311143 -8 Left 1049311140 8:141934562-141934584 CCTTCAGGCTGCAGAGGAATGAA No data
Right 1049311143 8:141934577-141934599 GGAATGAACTGGAGGCCACAAGG No data
1049311140_1049311144 4 Left 1049311140 8:141934562-141934584 CCTTCAGGCTGCAGAGGAATGAA No data
Right 1049311144 8:141934589-141934611 AGGCCACAAGGACAGCATCTAGG No data
1049311140_1049311146 14 Left 1049311140 8:141934562-141934584 CCTTCAGGCTGCAGAGGAATGAA No data
Right 1049311146 8:141934599-141934621 GACAGCATCTAGGACAAAACTGG No data
1049311140_1049311147 17 Left 1049311140 8:141934562-141934584 CCTTCAGGCTGCAGAGGAATGAA No data
Right 1049311147 8:141934602-141934624 AGCATCTAGGACAAAACTGGAGG No data
1049311140_1049311149 27 Left 1049311140 8:141934562-141934584 CCTTCAGGCTGCAGAGGAATGAA No data
Right 1049311149 8:141934612-141934634 ACAAAACTGGAGGGACAGCCAGG No data
1049311140_1049311150 30 Left 1049311140 8:141934562-141934584 CCTTCAGGCTGCAGAGGAATGAA No data
Right 1049311150 8:141934615-141934637 AAACTGGAGGGACAGCCAGGTGG No data
1049311140_1049311148 18 Left 1049311140 8:141934562-141934584 CCTTCAGGCTGCAGAGGAATGAA No data
Right 1049311148 8:141934603-141934625 GCATCTAGGACAAAACTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049311140 Original CRISPR TTCATTCCTCTGCAGCCTGA AGG (reversed) Intergenic