ID: 1049311145

View in Genome Browser
Species Human (GRCh38)
Location 8:141934592-141934614
Sequence TGTCCTAGATGCTGTCCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049311145_1049311149 -3 Left 1049311145 8:141934592-141934614 CCACAAGGACAGCATCTAGGACA No data
Right 1049311149 8:141934612-141934634 ACAAAACTGGAGGGACAGCCAGG No data
1049311145_1049311157 27 Left 1049311145 8:141934592-141934614 CCACAAGGACAGCATCTAGGACA No data
Right 1049311157 8:141934642-141934664 TGCAGTTCTCTGGGGCTGCTGGG No data
1049311145_1049311155 19 Left 1049311145 8:141934592-141934614 CCACAAGGACAGCATCTAGGACA No data
Right 1049311155 8:141934634-141934656 GTGGGCTGTGCAGTTCTCTGGGG No data
1049311145_1049311151 1 Left 1049311145 8:141934592-141934614 CCACAAGGACAGCATCTAGGACA No data
Right 1049311151 8:141934616-141934638 AACTGGAGGGACAGCCAGGTGGG No data
1049311145_1049311154 18 Left 1049311145 8:141934592-141934614 CCACAAGGACAGCATCTAGGACA No data
Right 1049311154 8:141934633-141934655 GGTGGGCTGTGCAGTTCTCTGGG No data
1049311145_1049311156 26 Left 1049311145 8:141934592-141934614 CCACAAGGACAGCATCTAGGACA No data
Right 1049311156 8:141934641-141934663 GTGCAGTTCTCTGGGGCTGCTGG No data
1049311145_1049311150 0 Left 1049311145 8:141934592-141934614 CCACAAGGACAGCATCTAGGACA No data
Right 1049311150 8:141934615-141934637 AAACTGGAGGGACAGCCAGGTGG No data
1049311145_1049311153 17 Left 1049311145 8:141934592-141934614 CCACAAGGACAGCATCTAGGACA No data
Right 1049311153 8:141934632-141934654 AGGTGGGCTGTGCAGTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049311145 Original CRISPR TGTCCTAGATGCTGTCCTTG TGG (reversed) Intergenic
No off target data available for this crispr