ID: 1049311149

View in Genome Browser
Species Human (GRCh38)
Location 8:141934612-141934634
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049311140_1049311149 27 Left 1049311140 8:141934562-141934584 CCTTCAGGCTGCAGAGGAATGAA No data
Right 1049311149 8:141934612-141934634 ACAAAACTGGAGGGACAGCCAGG No data
1049311145_1049311149 -3 Left 1049311145 8:141934592-141934614 CCACAAGGACAGCATCTAGGACA No data
Right 1049311149 8:141934612-141934634 ACAAAACTGGAGGGACAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049311149 Original CRISPR ACAAAACTGGAGGGACAGCC AGG Intergenic