ID: 1049311150

View in Genome Browser
Species Human (GRCh38)
Location 8:141934615-141934637
Sequence AAACTGGAGGGACAGCCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049311145_1049311150 0 Left 1049311145 8:141934592-141934614 CCACAAGGACAGCATCTAGGACA No data
Right 1049311150 8:141934615-141934637 AAACTGGAGGGACAGCCAGGTGG No data
1049311140_1049311150 30 Left 1049311140 8:141934562-141934584 CCTTCAGGCTGCAGAGGAATGAA No data
Right 1049311150 8:141934615-141934637 AAACTGGAGGGACAGCCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049311150 Original CRISPR AAACTGGAGGGACAGCCAGG TGG Intergenic
No off target data available for this crispr