ID: 1049311154

View in Genome Browser
Species Human (GRCh38)
Location 8:141934633-141934655
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049311145_1049311154 18 Left 1049311145 8:141934592-141934614 CCACAAGGACAGCATCTAGGACA No data
Right 1049311154 8:141934633-141934655 GGTGGGCTGTGCAGTTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049311154 Original CRISPR GGTGGGCTGTGCAGTTCTCT GGG Intergenic