ID: 1049311155

View in Genome Browser
Species Human (GRCh38)
Location 8:141934634-141934656
Sequence GTGGGCTGTGCAGTTCTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049311145_1049311155 19 Left 1049311145 8:141934592-141934614 CCACAAGGACAGCATCTAGGACA No data
Right 1049311155 8:141934634-141934656 GTGGGCTGTGCAGTTCTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049311155 Original CRISPR GTGGGCTGTGCAGTTCTCTG GGG Intergenic