ID: 1049311156

View in Genome Browser
Species Human (GRCh38)
Location 8:141934641-141934663
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049311145_1049311156 26 Left 1049311145 8:141934592-141934614 CCACAAGGACAGCATCTAGGACA No data
Right 1049311156 8:141934641-141934663 GTGCAGTTCTCTGGGGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049311156 Original CRISPR GTGCAGTTCTCTGGGGCTGC TGG Intergenic