ID: 1049311488

View in Genome Browser
Species Human (GRCh38)
Location 8:141936066-141936088
Sequence GGGCTGCCCTGGTCCCTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049311479_1049311488 -7 Left 1049311479 8:141936050-141936072 CCCTCCCACCTGCCCTGGGCTGC No data
Right 1049311488 8:141936066-141936088 GGGCTGCCCTGGTCCCTCCTGGG No data
1049311472_1049311488 14 Left 1049311472 8:141936029-141936051 CCAGGCAAGTCCCTCCCTAGGCC No data
Right 1049311488 8:141936066-141936088 GGGCTGCCCTGGTCCCTCCTGGG No data
1049311473_1049311488 4 Left 1049311473 8:141936039-141936061 CCCTCCCTAGGCCCTCCCACCTG No data
Right 1049311488 8:141936066-141936088 GGGCTGCCCTGGTCCCTCCTGGG No data
1049311480_1049311488 -8 Left 1049311480 8:141936051-141936073 CCTCCCACCTGCCCTGGGCTGCC No data
Right 1049311488 8:141936066-141936088 GGGCTGCCCTGGTCCCTCCTGGG No data
1049311474_1049311488 3 Left 1049311474 8:141936040-141936062 CCTCCCTAGGCCCTCCCACCTGC No data
Right 1049311488 8:141936066-141936088 GGGCTGCCCTGGTCCCTCCTGGG No data
1049311476_1049311488 -1 Left 1049311476 8:141936044-141936066 CCTAGGCCCTCCCACCTGCCCTG No data
Right 1049311488 8:141936066-141936088 GGGCTGCCCTGGTCCCTCCTGGG No data
1049311475_1049311488 0 Left 1049311475 8:141936043-141936065 CCCTAGGCCCTCCCACCTGCCCT No data
Right 1049311488 8:141936066-141936088 GGGCTGCCCTGGTCCCTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049311488 Original CRISPR GGGCTGCCCTGGTCCCTCCT GGG Intergenic
No off target data available for this crispr