ID: 1049312790

View in Genome Browser
Species Human (GRCh38)
Location 8:141942379-141942401
Sequence GCTGCTCTGCAGAAGGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049312784_1049312790 6 Left 1049312784 8:141942350-141942372 CCTGGCTCCTAGACAGGGCTGGC No data
Right 1049312790 8:141942379-141942401 GCTGCTCTGCAGAAGGTGGCTGG No data
1049312785_1049312790 -1 Left 1049312785 8:141942357-141942379 CCTAGACAGGGCTGGCTCCTCCG No data
Right 1049312790 8:141942379-141942401 GCTGCTCTGCAGAAGGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049312790 Original CRISPR GCTGCTCTGCAGAAGGTGGC TGG Intergenic
No off target data available for this crispr