ID: 1049316563

View in Genome Browser
Species Human (GRCh38)
Location 8:141972210-141972232
Sequence ATATAAATAGTAATTGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049316563_1049316570 18 Left 1049316563 8:141972210-141972232 CCTGCAGCAATTACTATTTATAT No data
Right 1049316570 8:141972251-141972273 TAATGGGCGGCTAACAGGCTTGG No data
1049316563_1049316566 5 Left 1049316563 8:141972210-141972232 CCTGCAGCAATTACTATTTATAT No data
Right 1049316566 8:141972238-141972260 GTCCCAGCACTGATAATGGGCGG No data
1049316563_1049316565 2 Left 1049316563 8:141972210-141972232 CCTGCAGCAATTACTATTTATAT No data
Right 1049316565 8:141972235-141972257 GCAGTCCCAGCACTGATAATGGG No data
1049316563_1049316564 1 Left 1049316563 8:141972210-141972232 CCTGCAGCAATTACTATTTATAT No data
Right 1049316564 8:141972234-141972256 TGCAGTCCCAGCACTGATAATGG No data
1049316563_1049316571 26 Left 1049316563 8:141972210-141972232 CCTGCAGCAATTACTATTTATAT No data
Right 1049316571 8:141972259-141972281 GGCTAACAGGCTTGGTTAATTGG No data
1049316563_1049316569 13 Left 1049316563 8:141972210-141972232 CCTGCAGCAATTACTATTTATAT No data
Right 1049316569 8:141972246-141972268 ACTGATAATGGGCGGCTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049316563 Original CRISPR ATATAAATAGTAATTGCTGC AGG (reversed) Intergenic
No off target data available for this crispr