ID: 1049316566

View in Genome Browser
Species Human (GRCh38)
Location 8:141972238-141972260
Sequence GTCCCAGCACTGATAATGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049316562_1049316566 6 Left 1049316562 8:141972209-141972231 CCCTGCAGCAATTACTATTTATA No data
Right 1049316566 8:141972238-141972260 GTCCCAGCACTGATAATGGGCGG No data
1049316563_1049316566 5 Left 1049316563 8:141972210-141972232 CCTGCAGCAATTACTATTTATAT No data
Right 1049316566 8:141972238-141972260 GTCCCAGCACTGATAATGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049316566 Original CRISPR GTCCCAGCACTGATAATGGG CGG Intergenic
No off target data available for this crispr