ID: 1049316567

View in Genome Browser
Species Human (GRCh38)
Location 8:141972240-141972262
Sequence AGCCGCCCATTATCAGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049316567_1049316571 -4 Left 1049316567 8:141972240-141972262 CCCAGCACTGATAATGGGCGGCT No data
Right 1049316571 8:141972259-141972281 GGCTAACAGGCTTGGTTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049316567 Original CRISPR AGCCGCCCATTATCAGTGCT GGG (reversed) Intergenic
No off target data available for this crispr