ID: 1049316571

View in Genome Browser
Species Human (GRCh38)
Location 8:141972259-141972281
Sequence GGCTAACAGGCTTGGTTAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049316562_1049316571 27 Left 1049316562 8:141972209-141972231 CCCTGCAGCAATTACTATTTATA No data
Right 1049316571 8:141972259-141972281 GGCTAACAGGCTTGGTTAATTGG No data
1049316567_1049316571 -4 Left 1049316567 8:141972240-141972262 CCCAGCACTGATAATGGGCGGCT No data
Right 1049316571 8:141972259-141972281 GGCTAACAGGCTTGGTTAATTGG No data
1049316563_1049316571 26 Left 1049316563 8:141972210-141972232 CCTGCAGCAATTACTATTTATAT No data
Right 1049316571 8:141972259-141972281 GGCTAACAGGCTTGGTTAATTGG No data
1049316568_1049316571 -5 Left 1049316568 8:141972241-141972263 CCAGCACTGATAATGGGCGGCTA No data
Right 1049316571 8:141972259-141972281 GGCTAACAGGCTTGGTTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049316571 Original CRISPR GGCTAACAGGCTTGGTTAAT TGG Intergenic
No off target data available for this crispr