ID: 1049316707

View in Genome Browser
Species Human (GRCh38)
Location 8:141973032-141973054
Sequence GCCAGGGTGTTCTGGGCAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049316696_1049316707 -10 Left 1049316696 8:141973019-141973041 CCCCCTGCCCCCAGCCAGGGTGT No data
Right 1049316707 8:141973032-141973054 GCCAGGGTGTTCTGGGCAATGGG No data
1049316691_1049316707 5 Left 1049316691 8:141973004-141973026 CCTTCTCTCCCACATCCCCCTGC No data
Right 1049316707 8:141973032-141973054 GCCAGGGTGTTCTGGGCAATGGG No data
1049316692_1049316707 -3 Left 1049316692 8:141973012-141973034 CCCACATCCCCCTGCCCCCAGCC No data
Right 1049316707 8:141973032-141973054 GCCAGGGTGTTCTGGGCAATGGG No data
1049316693_1049316707 -4 Left 1049316693 8:141973013-141973035 CCACATCCCCCTGCCCCCAGCCA No data
Right 1049316707 8:141973032-141973054 GCCAGGGTGTTCTGGGCAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049316707 Original CRISPR GCCAGGGTGTTCTGGGCAAT GGG Intergenic
No off target data available for this crispr