ID: 1049324425

View in Genome Browser
Species Human (GRCh38)
Location 8:142014651-142014673
Sequence GAAGCATCTGGACGTCCCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049324425_1049324427 0 Left 1049324425 8:142014651-142014673 CCGCAGGGACGTCCAGATGCTTC No data
Right 1049324427 8:142014674-142014696 ACCATCAGAACCCAGCAACTAGG No data
1049324425_1049324431 11 Left 1049324425 8:142014651-142014673 CCGCAGGGACGTCCAGATGCTTC No data
Right 1049324431 8:142014685-142014707 CCAGCAACTAGGACCGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049324425 Original CRISPR GAAGCATCTGGACGTCCCTG CGG (reversed) Intergenic
No off target data available for this crispr